MutY Homolog (E. coli) (MUTYH) - coding DNA reference sequence

(used for mutation description)

(last modified February 23, 2009)


This coding DNA reference sequence was created from RefSeqGene record NG_008189.1, transcript alpha 5, NM_001128425.1, for the description of sequence variants in the MUTYH gene following current HGVS recommendations. Note that exon 3 is alternatively spliced in several ways (e.g. NM_012222.2, NM_001048172.1 and NM_001048174.1). Due to the choice of the longest MUTYH-transcript (NM_001128425.1) as a reference, nucleotide and amino acid numbering after nucleotide position 157 (amino acid 53) may differ by up to 42 nucleotides (14 amino acids).

This coding DNA reference sequence was created from RefSeqGene record NG_008189.1, transcript alpha 5, NM_001128425.1, for the description of sequence variants in the MUTYH gene following current HGVS recommendations. Note that exon 3 is alternatively spliced in several ways (e.g. NM_012222.2, NM_001048172.1 and NM_001048174.1). Due to the choice of the longest MUTYH-transcript (NM_001128425.1) as a reference, nucleotide and amino acid numbering after nucleotide position 157 (amino acid 53) may differ by up to 42 nucleotides (14 amino acids).

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                               .         .         .         
                         cagccggagccgcggtgtacaacggaacttgtagtc       -181

 .         .         .         .         .         .         
 tcctcgtggctagttcaggcggaaggagcagtcctctgaagcttgaggagcctctagaac       -121

 .         .         .         .         .         .         
 tatgagcccgaggccttcccctctcccagagcgcagaggctttgaaggctacctctggga       -61

 .         .         .         .         .         .         
 agccgctcaccgtcggaagctgcgggagctgaaactgcgccatcgtcactgtcggcggcc       -1

          .         .         .       | 2  .         .         .
 ATGACACCGCTCGTCTCCCGCCTGAGTCGTCTGTGG | GCCATCATGAGGAAGCCACGAGCA     60
 M  T  P  L  V  S  R  L  S  R  L  W   | A  I  M  R  K  P  R  A       20

          .         .         .         .         .         .
 GCCGTGGGAAGTGGTCACAGGAAGCAGGCAGCCAGCCAGGAAGGGAGGCAGAAGCATGCT        120
 A  V  G  S  G  H  R  K  Q  A  A  S  Q  E  G  R  Q  K  H  A          40

          .         .         .        | 3 .       /    .         .
 AAGAACAACAGTCAGGCCAAGCCTTCTGCCTGTGATG | CCTGTGCAG / GGATGATTGCTGAG     180
 K  N  N  S  Q  A  K  P  S  A  C  D  A |   C  A  G /   M  I  A  E       60
                           alternative splice site ^     (see top)
          .       /     / .         .         .         .         .
 TGTCCTGGGGCCCCAG / CAG / GCCTGGCCAGGCAGCCGGAAGAGGTGGTATTGCAGGCCTCT        240
 C  P  G  A  P  A /   G /   L  A  R  Q  P  E  E  V  V  L  Q  A  S          80
                  ^     ^ alternative splice sites
          .         .         .         .         .         .
 GTCTCCTCATACCATCTATTCAGAGACGTAGCTGAAGTCACAGCCTTCCGAGGGAGCCTG        300
 V  S  S  Y  H  L  F  R  D  V  A  E  V  T  A  F  R  G  S  L          100

          .         .         .         .         | 4.         .
 CTAAGCTGGTACGACCAAGAGAAACGGGACCTACCATGGAGAAGACGG | GCAGAAGATGAG     360
 L  S  W  Y  D  Q  E  K  R  D  L  P  W  R  R  R   | A  E  D  E       120

          .         .         | 5.         .         .         .
 ATGGACCTGGACAGGCGGGCATATGCTG | TGTGGGTCTCAGAGGTCATGCTGCAGCAGACC     420
 M  D  L  D  R  R  A  Y  A  V |   W  V  S  E  V  M  L  Q  Q  T       140

          .         .         .         .   | 6      .         .
 CAGGTTGCCACTGTGATCAACTACTATACCGGATGGATGCAG | AAGTGGCCTACACTGCAG     480
 Q  V  A  T  V  I  N  Y  Y  T  G  W  M  Q   | K  W  P  T  L  Q       160

          .         .     | 7    .         .         .         .
 GACCTGGCCAGTGCTTCCCTGGAG | GAGGTGAATCAACTCTGGGCTGGCCTGGGCTACTAT     540
 D  L  A  S  A  S  L  E   | E  V  N  Q  L  W  A  G  L  G  Y  Y       180

          .         .         .       | 8  .         .         .
 TCTCGTGGCCGGCGGCTGCAGGAGGGAGCTCGGAAG | GTGGTAGAGGAGCTAGGGGGCCAC     600
 S  R  G  R  R  L  Q  E  G  A  R  K   | V  V  E  E  L  G  G  H       200

          .         .         .         .         .         .
 ATGCCACGTACAGCAGAGACCCTGCAGCAGCTCCTGCCTGGCGTGGGGCGCTACACAGCT        660
 M  P  R  T  A  E  T  L  Q  Q  L  L  P  G  V  G  R  Y  T  A          220

          .         .         . | 9        .         .         .
 GGGGCCATTGCCTCTATCGCCTTTGGCCAG | GCAACCGGTGTGGTGGATGGCAACGTAGCA     720
 G  A  I  A  S  I  A  F  G  Q   | A  T  G  V  V  D  G  N  V  A       240

          .         .         .         .         .         .
 CGGGTGCTGTGCCGTGTCCGAGCCATTGGTGCTGATCCCAGCAGCACCCTTGTTTCCCAG        780
 R  V  L  C  R  V  R  A  I  G  A  D  P  S  S  T  L  V  S  Q          260

          | 10         .         .         .         .         .
 CAGCTCTG | GGGTCTAGCCCAGCAGCTGGTGGACCCAGCCCGGCCAGGAGATTTCAACCAA     840
 Q  L  W  |  G  L  A  Q  Q  L  V  D  P  A  R  P  G  D  F  N  Q       280

          .         .         .         .         .         .
 GCAGCCATGGAGCTAGGGGCCACAGTGTGTACCCCACAGCGCCCACTGTGCAGCCAGTGC        900
 A  A  M  E  L  G  A  T  V  C  T  P  Q  R  P  L  C  S  Q  C          300

          .         .         .    | 11    .         .         .
 CCTGTGGAGAGCCTGTGCCGGGCACGCCAGAGA | GTGGAGCAGGAACAGCTCTTAGCCTCA     960
 P  V  E  S  L  C  R  A  R  Q  R   | V  E  Q  E  Q  L  L  A  S       320

          .         .         .        | 12.         .         .
 GGGAGCCTGTCGGGCAGTCCTGACGTGGAGGAGTGTG | CTCCCAACACTGGACAGTGCCAC     1020
 G  S  L  S  G  S  P  D  V  E  E  C  A |   P  N  T  G  Q  C  H       340

          .         .         .         .         .         .
 CTGTGCCTGCCTCCCTCGGAGCCCTGGGACCAGACCCTGGGAGTGGTCAACTTCCCCAGA        1080
 L  C  L  P  P  S  E  P  W  D  Q  T  L  G  V  V  N  F  P  R          360

          .         .         .         .         .         .
 AAGGCCAGCCGCAAGCCCCCCAGGGAGGAGAGCTCTGCCACCTGTGTTCTGGAACAGCCT        1140
 K  A  S  R  K  P  P  R  E  E  S  S  A  T  C  V  L  E  Q  P          380

          .         .         .         .       | 13 .         .
 GGGGCCCTTGGGGCCCAAATTCTGCTGGTGCAGAGGCCCAACTCAG | GTCTGCTGGCAGGA     1200
 G  A  L  G  A  Q  I  L  L  V  Q  R  P  N  S  G |   L  L  A  G       400

          .         .         .         .         .         .
 CTGTGGGAGTTCCCGTCCGTGACCTGGGAGCCCTCAGAGCAGCTTCAGCGCAAGGCCCTG        1260
 L  W  E  F  P  S  V  T  W  E  P  S  E  Q  L  Q  R  K  A  L          420

          .         .         .         .         .         .
 CTGCAGGAACTACAGCGTTGGGCTGGGCCCCTCCCAGCCACGCACCTCCGGCACCTTGGG        1320
 L  Q  E  L  Q  R  W  A  G  P  L  P  A  T  H  L  R  H  L  G          440

     | 14    .         .         .         .         .         .
 GAG | GTTGTCCACACCTTCTCTCACATCAAGCTGACATATCAAGTATATGGGCTGGCCTTG     1380
 E   | V  V  H  T  F  S  H  I  K  L  T  Y  Q  V  Y  G  L  A  L       460

          .         .         .         .         .         .
 GAAGGGCAGACCCCAGTGACCACCGTACCACCAGGTGCTCGCTGGCTGACGCAGGAGGAA        1440
 E  G  Q  T  P  V  T  T  V  P  P  G  A  R  W  L  T  Q  E  E          480

          .         .         .       | 15 .         .         .
 TTTCACACCGCAGCTGTTTCCACCGCCATGAAAAAG | GTTTTCCGTGTGTATCAGGGCCAA     1500
 F  H  T  A  A  V  S  T  A  M  K  K   | V  F  R  V  Y  Q  G  Q       500

          .         | 16         .         .         .         .
 CAGCCAGGGACCTGTATG | GGTTCCAAAAGGTCCCAGGTGTCCTCTCCGTGCAGTCGGAAA     1560
 Q  P  G  T  C  M   | G  S  K  R  S  Q  V  S  S  P  C  S  R  K       520

          .         .         .         .         .         .
 AAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTCTCACATCTCCACTGAT        1620
 K  P  R  M  G  Q  Q  V  L  D  N  F  F  R  S  H  I  S  T  D          540

          .         .         .
 GCACACAGCCTCAACAGTGCAGCCCAGTGA                                      1650
 A  H  S  L  N  S  A  A  Q  X                                        549

          .         .         .         .         .         .
 cacctctgaaagcccccattccctgagaatcctgttgttagtaaagtgcttatttttgta        *60

     
 gtta                                                                *64

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The MutY homolog (E. coli) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.1.1.0 Build 13
2004-2006 Leiden University Medical Center